courtneykeller6 courtneykeller6

02-10-2017
English

contestada

Fragment or complete sentence? Hard to choose from the many available types of cell phones.

Respuesta :

patrishacraft patrishacraft

02-10-2017

That is a fragmented

Answer Link

Pottergasm17 Pottergasm17

02-10-2017

It's a fragment. It doesn't have a subject.

Answer Link

Otras preguntas

Find the area of the Triangle! A. 2.35 in2 B. 2.85 in2 C. 5.7 in2 D. 8.72 in2 will give brainliest!!

Which cells contain chloroplasts? (1 point) O cells in animal brains O cells in animal muscles O cells in plant leaves O cells in plant roots and stems

Please help me with this

Operations law includes: A. the treatment of prisoners of war. B. allowable targets in warfare. C. appropriate use of weapons. D. all of the above.

The sun is At the equator during the spring equinox

Adolph Hitler's use of propaganda against the Jews led to them being persecuted, rounded up, sent to concentration camps and ghettos, and exterminated. By the e

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Pls help me with this and pls make sure of ur answer and dont just answer for points plsss it’s important

Please can i have the answer to both of these questions I will mark you brainliest

NASA’s first attempt to achieve human space flight was called the Apollo program. Gemini program. Mercury program. Explorer program.