jikyakeyashia jikyakeyashia

01-09-2017
Mathematics

contestada

Add 5/12 + 69/10 enter you answer below as a fraction in lowest terms using the slash ( / ) as the fraction bar

Respuesta :

texaschic101 texaschic101

01-09-2017

5/12 + 69/10....LCD = 60
25/60 + 414/60 =
439/60 <== and this will not reduce

Answer Link

tbabymoore1234 tbabymoore1234

17-10-2021

Answer: 439/60

Step-by-step explanation:

Answer Link

Otras preguntas

find the differnce between 6 weeks 2 days and 3 weeks 5 days

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

What is the variable equal to? t • 7 = 63 t = 12 t = 8 t = 9 t = 441

1/3 X 2034 i really can’t figure this out

The cost to replace a water pump in a sports car was $483. This included $305 for the water pump and $89 per hour for labor. How many hours of labor were requir

What is the main component of the plasma membrane?

Identify the term that best describes the italicized words. (Developed by government scientist), the Internet is now part of every day life A- appositive phrase

the base of a cube is shown. the area of the base is 1/4 ft ^ 2. what is the volume of the cube

the function f(x) is defined by the graph below and the function g(x) is defined by the formula g(x)=-2x-5. find the value of f(g(3)). show the work that leads

If 7 newborn babies are randomly selected, how many different gender sequences are possible?