SabirinJ314296 SabirinJ314296
  • 03-11-2022
  • Mathematics
contestada

V8 to the nearest tenth is about ?

Respuesta :

SiarahE632535 SiarahE632535
  • 03-11-2022
[tex]\sqrt[]{8}\approx2.8[/tex]

Answer Link

Otras preguntas

The table below shows the cost of sending packages of various weights. What is the cost of mailing a 4-ounce package?
Can someone write me an essay on how education can help both me and others
What's 2+2 I really need this answer plz help ASAP
Russell runs 9/10 mike in 5 mins. How many miles does he run in one minute
Please help ASAP! Will give brainlist!
3.7 x 0.25 please show me the steps on how to solve thank you
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
More than 13,000 years ago, humans in south Greece were domesticating snails. The advantage(s) of snails as a food source is/are:
solve the inequality -7/2(12x+6)<8-5x help please ​
Find the area of the figure below, formed from a triangle and a parallelogram. 22 square millimeters O 34 square millimeters O 32 square millimeters 0 44 square