spotty32 spotty32
  • 03-02-2017
  • English
contestada

What word means the authors point of view?!

Respuesta :

Аноним Аноним
  • 03-02-2017
An authors point of view is just that, his/her point of view. No word means it, it just is. I hope this was helpful, and good luck! (:
Answer Link
rachel03
rachel03 rachel03
  • 03-02-2017
First person point of view.
Answer Link

Otras preguntas

When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?
Name all of the traits that the mackerel has, based on this cladogram.
difference between syntax and semantics
Does the increase in blood glucose levels increase the viscosity of the blood
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Under the articles of confederation, political power and authority ultimately rested with the ________.
Joseph and cleoma, who made the first cajun recording, were husband and wife
Find the measure of an exterior angle of each regular polygon: 100-gon.
[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of
What was a major effect of the agricultural revolution in the united states during the late 1800's?