laabsm102 laabsm102

04-03-2021
Mathematics

contestada

What is the GCF of 16x5y2 + 40x4y3? 4x5y3 4x4y2 8x5y3 8x4y2

Respuesta :

jasminev4 jasminev4

04-03-2021

Answer:

8x^4y^2

Step-by-step explanation:

Answer Link

Otras preguntas

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?

Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple

Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron

what is the answer to #16???? Helpppppp

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.

Attorney general a. mitchell palmer believed that he needed to protect the american people from

Latin prefix opposite of mini-

Simplify the expression completely. x squared over x to the power of 6

Why did some americans feel that the united states should help europe after world war ii?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat