kailahlashe4 kailahlashe4

01-04-2020
Mathematics

contestada

Can someone answer these for me ? Thanks .

Can someone answer these for me Thanks class=

Respuesta :

abby12510 abby12510

01-04-2020

I showed the work, so hopefully this helps you. Have a good day!

Ver imagen abby12510

Answer Link

Otras preguntas

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

does mercury have a magnetic field

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

help me asap !!!!!!!!

20% of what number is equal to 2/3 of 90?

Groups that are more formal and require less continuous interaction are known as what type of group?

Pls answer this question

Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies