lnsunflower lnsunflower
  • 04-03-2019
  • Social Studies
contestada

What the difference between the Patriots and the loyalist?

Respuesta :

Ziah79
Ziah79 Ziah79
  • 04-03-2019
The difference between a patriot and a loyalist is patriots were people who wanted the American colonies to gain their independence from Great Britain. A loyalist was a person who was loyal to the British government both during the revolutionary war.
Answer Link

Otras preguntas

How was President Polk’s argument for annexation informed by the concept of Manifest Destiny?
What is a good distance to aim for if you are a beginning hiker? A.3 km В.5 km C.8 km D.12 km​
Dominic is a server at a restaurant. Each dish at the restaurant costs $8. A sales tax of 8% is charged. The total bill amount includes the sales tax of the mea
Rohail sell 300g of cashew nuts . Gauhar sell 150g more than Rohail. What is the total weight sold?
Suppose you meet a fairy in a park. What will you ask for if the fairy allows you to make three wishes?
To what extent does a lack of resources cause economic and social problems
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
what is pepsinogen and how does it helps in digestion of protein ? ​
Mary has read 150 pages of her 250 page book. What percent of her book has Mary read?
What are some of the factors that cause interior migration?