01-03-2019
Biology

contestada

What makes the earth go around the sun,the planets round and things fall

Respuesta :

triggercell triggercell

01-03-2019

Correct me if I'm wrong but I believe it is the Gravity (or Gravitational Pull) from the Sun.

Answer Link

Otras preguntas

How is the creation of public policy in Russia different from that in the United States?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

need help anybody know how to do this

What are some examples of dramatic irony in The Hobbit?

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

accounting i know that when there's two panels its debit and credit but what is the third for what is each one

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

Can someone Help me with that please

Explain how infection prevention policies and guidelines can be applied in own work setting.