annapittbull12
annapittbull12 annapittbull12
  • 01-02-2019
  • Mathematics
contestada

i don't get undoing if its pass adding and subtracting so can someone help? x-2 over 5 = 18

Respuesta :

jessica94866
jessica94866 jessica94866
  • 01-02-2019

Answer:

92


Step-by-step explanation:

First, undo the division. You can do this by multiplying 18 by 5. You get 90. Then, undo the subtraction. You can do this by adding 2 to 90. You will get 92. Your answer is 92!

Check: 92-2=90, 90 divided by 5 is equal to 18!

Hope this helps!


Answer Link

Otras preguntas

What is the most likely connotation of the word snatched in the following sentence? Max snatched the diary from his sister's hand. A. A negative connotation tha
In at least 150 words, explain how the word choice in Rukeyser's "Poem" helps the author to establish a theme in the text. Use details from the poem to support
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
what is the following answer for 7/4 x 10? (1) 14 (2) 18 1/4 (3) 28 (4)30 1/2
Can someone help me and explain how I get the answer?
Hey y'all im back, back again!
Determine maximum and minimum value of the function y=4x-x^2 +3
How should raw animal proteins be stacked prior to cooking? based on first in-first out principles according to freshness in a separate cooler from all cooked f
I need the answer quickly, please.
plz solve ive been stuck on this