hayl2orialop
hayl2orialop hayl2orialop
  • 02-04-2016
  • Social Studies
contestada

what do i need to file taxes

Respuesta :

garydesir1
garydesir1 garydesir1
  • 02-04-2016

You will need social security numbers and dates of you


I hope that's help !

Answer Link

Otras preguntas

Workmen used 3/4 of a pallet of pavers to build 6 steps leading up to the mansion. Each step they built was the same size. How many pallets did they use for eac
Guys i need help I would be so grateful. I have to write an essay about this and im not good at that. Please help, thank you soooo much. ​
someone pleaseee help meee!!!
Can anyone pls help me in this pls I will mark u as brainliest
There are 1,000 grams in a kilogram.How would you convert 600 kilograms into grams?
What did Santa Anna feel confident that the Texans wouldent attack
A 70-liter tank of oxygen gas at 27 degree Celcius and 42.0 atm springs a leak overnight. when the tank was found in the morning, the pressure in the tank had d
If the rectangle below has an area of 40sq. units, what is the area of the triangle?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
On August 1, Ling-Harvey Corporation (a U.S.-based importer) placed an order to purchase merchandise from a foreign supplier at a price of 400,000 ringgits. Lin